^{The News}
Dedicated to Austrian-Hungarian Burgenland Family History

This newsletter concerns:

1) THE PRESIDENT'S CORNER

2) A SWEET AND SIMPLE EXPLANATION OF CENTIMORGANS AND SNPS
    (by Jane Horvath)

3) AN INTERESTING VILLAGE CONFUSION

4) LANDSCAPE HISTORY OF WEST HUNGARY'S MOUNTAIN AREAS

5) HISTORICAL BB NEWSLETTER ARTICLES:
    - BURGENLAND IMMIGRANT NEIGHBORHOOD ENTREPRENEURS

6) ETHNIC EVENTS

7) BURGENLAND EMIGRANT OBITUARIES (courtesy of Bob Strauch)

In the above table, versions of a month's name are separated by commas.

Some specific notes: In the Latin column, the "extra" names are the older names derived from numbered months and the "short" forms of those numbered months. In the German column, the "Jänner" term is an Austrian-specific variation. In the Croatian column, the second entries are the informal, ordinal names: prvi (first), drugi (second), treci (third), etc. month. It is, however, quite rare to see any of the Croatian terms used in Burgenland records.



Pictures Need People Identified: BB VP Klaus Gerger wrote to say that "BB member and friend Reinhard Strobl from Kleinmürbisch found a photo album in the attic of his grandparents' farmhouse. It contains photos from the 1910s, 1920s or 1930s taken in Allentown / Northampton, PA, at Lenhart's photo studio. Reinhard has no information about the people and families in the pictures, guessing that they are friends or relatives of his grandparents (and so from the Kleinmürbisch / Güssing area). But there is no proof."

Reinhard put the pictures into an online album that Klaus moved to the BB server, asking that I provide a newsletter notice about it, which I am glad to do in this note. Reinhard hopes that some newsletter readers will recognize some of these pictures and share information about them with him.

Here is Reinhard's request:

Who can help with information about old pictures from the 1910s / 1920s / 1930s made in the US (Allentown, PA)?

My name is Reinhard Strobl. I’m a BB member since 2003 and doing genealogical research around my home village Kleinmürbisch in the district of Güssing, province Burgenland in Austria.

At the loft in the house of my (great) parents I have found an interesting photo album with a lot of old pictures most likely taken in the 1910s / 1920s /1930s. All of them seems to be taken in the US—in Allentown, PA—studio Lenhart’s. Most of these pictures I have scanned, but unfortunately I haven't found any notice about the persons / families in the pictures—and, so far, I wasn’t able to identify any person.

In my opinion, most likely the pictures show persons from the South Burgenland area who emigrated to the US (perhaps with a relation to the village of Kleinmürbisch of district Güssing).

The scanned pictures can be viewed via the following link (on the BB Webpage): http://www.the-burgenland-bunch.org/Temp/BB_Strobl_Pics/index.html

The web page shows thumbnails on the left side, with the selected picture shown with higher resolution on the right area of the screen (and the file name below). By clicking on the larger picture the full-sized picture is shown.

If any of the BB Newsletter readers have knowledge about persons / families shown in the pictures, I would appreciate feedback. My email address is reinhard.strobl@direkt.at.

Ich hoffe, du kannst mir in der Sache weiterhelfen.
(I hope you can help me in this matter.)

Mit freundlichen Grüßen
Reinhard Strobl

Please contact Reinhard at the above email address if you can help.



Eisenstadt "Loop" Creating Trouble: You likely are unaware that a small planned railroad construction project has created friction between Burgenland's capital city, Eisenstadt, and its nearby neighbor, Wulkaprodersdorf. In fact, some 300 Wulkaprodersdorf residents recently blocked local roads by marching in protest.

          

I'm sure you are asking "what is this Loop? ...I sure didn't know! A Loop is a small piece of railroad that would add another connection between two railroad lines that currently meet in a Y configuration (see "Proposed New Track" in map above; the existing track is shown in thin, black lines). The problem with a Y configuration is that, if you are coming down one arm of the Y and wish to go up the other arm, you have to stop at a station on the leg of the Y, get off of your current train, cross the tracks, then wait for a train going in the opposite direction and up that other arm of the Y. That is you have to do a "Stürzen"—a flip (a change of direction)—to continue your journey. But a Loop, a small length of curving track that goes between the arms of the Y, like this, , allows a train to come down one arm and go up the other arm, no flip (or second train) required!

Now your next questions are "why is this needed?" and "why is it causing problems?"

Well, need depends on your point of view... from Eisenstadt's point of view, which is on one arm of the Y, a Loop lets people get on a single train in Eisenstadt and arrive in Vienna 45 minutes later, a savings of 17 minutes over the best current two-train connection and a reduction in hassle. And from a central railroad and government planning perspective, it reduces travel time and improves quality of the Vienna-to/from-Eisenstadt rail routes, thereby making public transport more attractive, increasing ridership, and shifting the "modal" split in favor of rail over roads.

However, from Wulkaprodersdorf's point of view, things are not so positive. First, there is already a train station in Wulkaprodersdorf that allows travel in both directions, from/to the arms, as Wulkaprodersdorf is on the leg of the Y. Second, the Loop would be built totally on the Wulkaprodersdorf hotter, taking farm land from it and adding more train traffic, with its noise and pollution. Further, it would require moving the intersection of two major local roads and construction of an awkward overpass roundabout to remove the grade-level intersection of roads and rail (see map below). And all of this would cost some 20 million Euros that the locals argue could be better spent on other projects (the 20 Million includes other changes that will be need to be made elsewhere along the route).



This is a proposal that has been 12 years in planning, but if approved in February, construction will start in 2020. Thus, "push has come to shove" and the local protest movement is in action. From their point of view, it is a proposal that only benefits others and costs them, so it is a problem... and they want others to know how they feel, even if they add to those problems via protests and road blockages. Not surprisingly, though, they are less opposed to the alternative, more expensive route shown on the upper map, as it is in someone else's backyard!



BB Email Link Problem: It has come to our attention that email links on the BB Surnames Pages did not work as intended in a certain situation. The problem appeared when gMail was the default mailer and the Chrome browser was used (both are Google products).

Our Surnames Pages are set up using frames, a coding technique that creates multiple sub-windows within the main window (each sub-window being in its own frame). That technique allows us to have a top menu with the title and backlinks, a side menu with the alphabetic subsets listed, and the data region where the actual surnames listings appear.

In the surnames listings, the researcher's name is underlined, indicating it has an email link tied to it. Clicking such a name should cause your email program to open up a message composition window with the To: email address and Subject: title filled in, so you can send a message to that researcher. However, doing so in the Chrome browser with gMail as your mailer resulted in a blank data region rather than opening gMail.

Almost certainly, this was a Chrome problem, as they removed some support for frames a number of years ago. We presume that every other web-based mailer behaved similarly with Chrome (but haven't tested that presumption). Mail programs that are installed on your local device (like Outlook or MS/Mail) work as intended with Chrome and frames.

We are exploring solutions for this problem and think we have found a fix, which we have implemented. However, if your system is configured with Chrome and gMail and your attempt to contact a fellow researcher still fails, I suggest you find that researcher on our Members Pages and use the email link there; those pages do not use frames so will work OK. And then contact me and tell me that the frames-related problem still exists!

In addition, if you have some other configuration and our email links do not generate an email window for you, please tell us what browser and email configuration you use and how it fails... we'll try to fix those too.



Recent FamilySearch Records Additions: Below is a small sample of the record sets that FamilySearch.org added in the past two months. As always, I provide this to remind you that their collection is not static and that it remains worthwhile to periodically repeat your family name searches. The sample below adds up to over 4 million new records ...but that is only a fraction of the 128 million total records added during this time!

  

Book on Pilgersdorf: BB Member JoAnne Middaugh passed along a request for information about emigrants from Pilgersdorf that is intended as part of a chapter in a new book about that town. The request is from Rudolf Schabl, from Austria, who is supporting the author, Professor Josef Schermann, in this research. It seemed like a good cause so I'm passing the request along to you...



Rudolf Schabl writes: My name is Rudolf SCHABL from Austria. Some time ago, I started to create the family tree for our family: Schabl (in USA Schable), Lindner, Hofer, Baumgartner, Zettl, Schermann, Puhr etc., available on: https://www.myheritage.at/site-375924351/schabl

The reason for my letter is as follows:

I support Mr. Prof. Josef Schermann, a historian, who is currently writing a book about Pilgersdorf, a village in Burgenland, Austria. This village was previously known as Pörgölény, when it was a part of Hungary during the monarchy.

This book also contains a chapter on emigrants to the USA and Canada. Since we don't have very much data from these people, I thought it might be able to get some more information this way. I am therefore sending this letter to as many people as I can find about MyHeritage (a database for genealogical research), who may have ancestors from Pilgersdorf. Although I have found some data via MyHeritage, they are often not really accurate.

I kindly ask you to inform descendants of emigrants from Pilgersdorf about my project. Perhaps some of them are still living in your neighborhoods? The book is expected to be published in about one year. Therefore it would be great to receive your feedback within the next weeks/few months.

I would be very grateful for the following data of the emigrates / relatives from Pilgerdorf / Pörgölény to USA and Canada.

• The exact name and, if available, the date of birth and place of birth, as well as the dates of family members, that traveled with them or followed them.

• The date of emigration and from where they left by ship and where they arrived in the USA.

• Where they have settled or traveled further in the USA.

• Since most of these people are no longer alive, the date and place of death would also be of interest.

If someone is looking for information of his ancestors or relatives in Austria, I am of course willing to help as far as I can. Do not hesitate to contact me. I would like to express my sincere thanks for your support!

Best regards from Austria,
Rudolf Schabl
Mail: rudolf@schabl.net
Tel.: +43 676 70 85 716

  

Update for book "The Burgenländer Emigration to America": Here is this month's update on purchases of the English issue of the 3rd edition of Dr. Walter Dujmovits' book "Die Amerika-Wanderung Der Burgenländer."

Current total sales are 1268 copies, as interested people purchased 14 more books during this past month.

As always, the book remains available for online purchase at a list price of $7.41 (which is the production charge for the book, as we purposely choose not to make a profit so we can avoid dealing with the income tax consequences and so you can obtain the book at as low a cost as possible!), plus tax & shipping. See the BB homepage for a link to the information / ordering page and for any current discounts (and there is at least one discount on price or shipping available most of the time... if not, wait a few days and there will be one!).



Burgenland Recipes: This recipe comes from BB member Pauline Greenlick. Her grandmother is from Neuberg and worked in the kitchen of Kaiser Franz Josef (1830-1916), who was fond of a very similar dessert called Schmarrn. After emigrating to the US, she would make this dessert for Pauline's family when they visited. When Pauline traveled to Neuberg in the late 90's, her cousin served something similar to this recipe, so her grandmother's dish still lives on.

ISHMON
(from Pauline Greenlick)

Dough:
2 eggs
1/4 cup of sugar (or less to taste)
1/4 tsp. salt
1/4 cup of milk (or more as needed)
1/4 - 1/2 cup of flour

For serving:
a little bit of powdered sugar

Instructions:
- Beat the eggs, add 1/4 cup of milk and beat in the remaining dry ingredients. If needed, add a bit more milk so that the mixture pours easily.
- Pour the above into a pan and scramble.
- Serve on individual plates and dust lightly with powdered sugar.



Reminder: We no longer have a "regular" source for Burgenland recipes. As evidenced above, a few readers have shared favorite family recipes, and we do have a reserve for a couple of months now, but if contributions stop coming in, we'll be begging again! So, please consider sharing your favorite Burgenland recipes or recipe books with us. Our older relatives sadly aren't with us forever, so don't allow your allow your favorite ethnic dishes to become lost to future generations. Send your suggestions to BB Recipes Editor, Alan Varga. Thanks!



Cartoon of the Month:

    

CentiMorgans

"A centiMorgan (cM) or map unit (m.u.) is a unit of recombinant frequency which is used to measure genetic distance. It is often used to imply distance along a chromosome, and takes into account how often recombination occurs in a region." ¹

While that may be an accurate definition, ISOGG assumes the reader already has an understanding of genetic recombination. Maybe the definition for SNPs will be a little clearer...

"A single-nucleotide polymorphism (SNP, pronounced snip) is a DNA sequence variation occurring when a single nucleotide adenine (A), thymine (T), cytosine (C), or guanine (G]) in the genome (or other shared sequence) differs between members of a species or paired chromosomes in an individual." ²

Although this is technically accurate and useful information for genetic researchers, it can be argued that the average genealogist does not need to obtain immediate mastery of this complex topic. It may be unorthodox, but understanding cMs and SNPs can be a whole lot easier if we look at genetics as something more familiar and delicious, like a chocolate bar.

Like chromosomes, chocolate bars have segments. Below, we have a pair of these figurative chocolate chromosomes, each with seven segments. The centiMorgans are the six “break” points between the segments.

Each chromosome has a different number of centiMorgans, and this number varies slightly depending on the testing company. Chromosome 1, for example has about 280cM, while chromosome 21 only has about 70 cM.³ This means there are about 280 “break” points where DNA segments are likely to split and rearrange with each generation on chromosome 1.

If this piece of chocolate were to fall on the ground, it will likely break at one or more of the recessed spots between the squares. Let’s imagine that this chocolate bar isn’t perfectly uniform and some of the break points are weaker than others. When dropped, the weaker spots would be more prone to breaking, just as certain parts of DNA segments are more prone to recombination.

In genetic recombination, each parent contributes one entire chromosome to each of the 23 pairs a child inherits. Let’s say the broken chocolate chromosome above came from your mother. This chocolate segment is made up segments from your mother’s ancestors. The other chromosome in the pair, from your father, may have “broken” in another place entirely. Though some spots are more likely to break, or recombine, than others, the process is ultimately random.

Although you received half of your DNA from each of your parents, the percent distribution begins to vary as the distance between you and the ancestor increases. Grandparents each contribute approximately 25% to your DNA, but it is common to share more with one of the four grandparents than the other three.

In the image above, this is the (not yet broken) segment inherited from your mother. The tinted squares show their origin and, in this example, the segment contains more DNA from your mother’s paternal grandfather than from her other grandparents. In this way, siblings may inherit entirely different sections of DNA from their grandparents and great-grandparents, and so on.

Unlike break points on chocolate bars, which divide equally-sized squares, centiMorgans do not occur between identically-sized bits of genetic code. As previously stated, a cM is not a unit of length, but a unit of recombinant frequency. To better illustrate this concept, I present the very strange-looking pairs of chocolate bar segments below.

Each chromosome in a pair has the same number of centiMorgans (ignoring the X and Y chromosomes for now—they play by their own rules) and the image above represents two different pairs of 7cM chromosome segments. With only cM values to compare, both of these have the same genetic significance, even though one is clearly longer. And to reiterate, a cM is a spot on a chromosome segment that is likely to split and recombine. This is why we count the spaces between the chocolate sections and not the sections themselves.

A segment from either of these pairs could refer to a 7cM segment showing “in-common-with” one of your DNA matches. It’s even possible for the smaller segment to have more genetic data. This is where SNPs come into play.

A strand of DNA is represented by combinations of the letters A, C, G, and T. These letters represent the individual building blocks of our DNA, called nucleotides. The code we each inherit from our parents is a replica of segments of our parent's code—with a few exceptions. About once every 300 nucleotides, one of the letters will change. This change is called an SNP.

Below are two nearly-identical lines of code. The top line represents the code from a parent and the bottom line represents the code inherited by their child. Look closely you’ll see the letter G in the second strand is the only difference between these two lines of code.

ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGC

ACAAGATGCCATTGTCCCCGGGCCTCCTGCTGCTGCTGC

That G is a sort of genetic “typo,” ⁴ or a nucleotide that has mutated. A nucleotide that has mutated is aptly called a single nucleotide polymorphism, or SNP. Although the word “mutation” sounds bad, its actually a normal part of human evolution and it is from these mutations that we are able to use DNA testing to identify relatives. When two people share enough of these “typos,” it can be assumed they received these bits of code from a common ancestor and are therefore related.

To illustrate SNPs, I’ll throw some sprinkles on this chocolate segment.

As previously stated, SNPs occur about once every 300 nucleotides, but that is only an average. There are portions of certain chromosomes that have much fewer mutations than others. Like the sprinkles on this chocolate bar, they are not evenly spaced. Although the second chocolate segment from the left may be the biggest, it has the fewest sprinkles, or the smallest number of SNPs.

In DNA testing, the SNPs in your code are compared to the SNPs of other users in their database. Each testing company has a threshold, or minimum criteria in order to show another user as your match. Usually, this is a combination of number of matching SNPs along with a minimum cM count.

Per 23andMe:

"Our simulations have concluded that we can confidently detect related individuals if they have at least one continuous region of matching SNPs (Single Nucleotide Polymorphisms) that is longer than our minimum threshold of 7cM (centiMorgans) long and at least 700 SNPs." ⁵

FamilyTreeDNA’s criteria focuses less on SNPs and more on cMs:

"A match is declared if two people share a segment of 9 cM or more, regardless of the number of total shared cM. However, if there’s not a block that’s 9 cM or greater, the minimum of 20 shared cM with a longest block of 7.69 cM applies … Criteria for X-chromosome matches: 1 cM and 500 SNPs for both males and females; matches must already meet the autosomal DNA matching criteria.^{" 6}

Hopefully this far-from-clinical analogy helps to demystify centiMorgans and SNPs. For the beginner, understanding the very basic concepts is really all that’s needed to get started. I recommend visiting the International Society of Genetic Genealogy ⁷ or any of these ISOGG-approved blogs ⁸ for more advanced DNA resources.

References:
1. isogg.org/wiki/CentiMorgan
2. isogg.org/wiki/Single-nucleotide_polymorphism
3. isogg.org/wiki/CentiMorgan
4. 23andme.com/gen101/snps/
5. customercare.23andme.com/hc/en-us/articles/212170958-DNA-Relatives-Detecting-Relatives-and-Predicting-Relationships
6. isogg.org/wiki/Autosomal_DNA_match_thresholds
7. isogg.org
8. isogg.org/wiki/Genetic_genealogy_blogs

Ed: The "Morgan" in centiMorgan was named after Thomas Hunt Morgan (1866–1945), the American Nobel-prizewinning geneticist often described as the father of modern genetics.
 

Köszönöm az információt! Pontosítom a lakóhelyet: Nyulas = Hasel (Ober-Pratscher és Unterhasel Bernstein mellett)

Which I translated (with both GoogleTranslate and a translating dictionary's help) to:

Thanks for the information! I clarify the place of residence: Nyulas = Hasel (near Ober-Pratscher and Unterhasel Bernstein)

That threw me into a bit of a spin because nothing I have ever seen suggests that Hasel (Ober- or Unter-) has ever been called Nyulas.

After some research into this, I wrote back (again with both GoogleTranslate and a translating dictionary's help) to András saying (I'll give you my intended English version too):

’Hasel’ soha nem hívtak ’Nyulas’, András.
=(in English)
  'Hasel' has never been called 'Nyulas', András.

Német / Magyar
Hasel = mogyoróbokor
Hase = mezei nyúl
Kaninchen = nyúl
Ez magyarázhatja a helynévvel kapcsolatos zavart.
=(in English)
  German / Hungarian
  Hasel = hazelnut
  Hase = hare rabbit
  Kaninchen = rabbit
  This may explain the confusion associated with the place name.

That is, I suspected that there was a confusion between the German words Hasel and Hase, which translate into English, respectively, as Hazel(nut tree) and hare (as in a specific type of rabbit) and into Hungarian, respectively, as mogyoróbokor (hazelnut) and mezei nyúl (hare rabbit). To be honest, I was hoping my attempt to translate between German and Hungarian would be more helpful than harmful ...but I truly wasn't sure about that when I sent it!

Evidently, I did OK, as András replied:

Köszönöm a pontosítást. A téves fordítás a családi hagyományból fakad.
Oseim adták így tovább, valószínu ok tudták rosszul...
=(in English)
  Thanks for the clarification. Wrong translation stems from family tradition.
  My ancestors went on, they probably knew they were wrong ...

So it appears András was making reference to Hasel, and I think Oberhasel specifically, which is only 2 km south-southeast of Bernstein and within its Gemeinde, but not large enough to be considered even an Ortsteil; it's just a named populated place. The fact is that the birth record I noted in my first message implies that the parents of Janós Pratscher were legal residents of Redlschlag (which is an Ortsteil of Bernstein)... but they could have been physically located in Oberhasel anyway or moved there some time later before moving on to Nemeskér, Hungary.

Further, it appears that his ancestors liked to play word games, as András notes... nyulas, in Hungarian, means abounding in rabbits/hares, so they went from Hasel to Hase in German and then nyúl to nyulas in Hungarian to rename their place of emigration. Perhaps Oberhasel had a lot of rabbits too back then!

As an interesting side comment, I'll note that it seems likely that Ober- and Unter- Hasel are in an area that once was a hazelnut tree forest and was, therefore, named for those trees. Hazelnut trees were considered quite valuable, as were most other nut-bearing trees).

In the excerpt from an old Hungarian map shown here, the area was labeled “Haselgrund vel Hasel Hauser”, which is a curious mix of German and Hungarian, translating to “Hazel ground with Hazel Homes.” If this had been expressed only in German, it would be: Haselnussgrund mit Hasel Häuser ...and solely in Hungarian, something like: Mogyoróföld val vel Mogyorós házak.

I find this extra interesting because I had written a pending article (which will now follow below this article) concerning the old use of forests in West Hungary, and nut trees are part of that discussion.

Now back to András' family research: One thing I noted was that the maiden name was not listed for the mother in the 1850 birth record for Janós Pratscher. Searching forward in the Bernstein records did not reveal any more births by a Mátyás & Anna Pratscher couple. However, working backwards does provide a birth record for a Mátyás Pratscher born April 7, 1848, with parents Mátyás Pratscher and Anna Kirnbaur, again labeled Röthelslagi. Mátyás is also listed as a varga (shoemaker). And there is one for Mária Prátscher, born October 26, 1844, with the mother's surname written as Kirnbauer; and a Rosina on September 4, 1841, though this time the mother is just listed as Ánná Prátser, though some of the witnesses match with those of Mátyás and Mária, making it likely these are the same parents; and another Rossina on April 4, 1840, but this time the mother is listed as Kirnbaur again; and Josef on March 17, 1839, with mother Anna being a Kirnbauer this time; then Erzebeth on November 18, 1837, which seems to be the earliest child, at least in these records. I do have a suspicion that Mátyás & Anna may have married (and possibly first lived for a while) in another village (likely Anna's), as the marriage for the couple does not appear in the Bernstein records. One would assume that her village was reasonably nearby... but I didn't look for it; have to leave something for András to do!

And a late follow-up: Just recently, I received a message from András that indicated I had found the wrong Janós Pratscher, wrong mostly because Janós was actually born in/near Bernstein in 1814! Given András originally said that Janós was born "about 1850," it is not surprising that I found the wrong one (one born in 1850!). In fact, he tells me that, correctly, it was a marriage for Janós that was "about 1850," and it took place in Nemeskér, Hungary. Unfortunately, the available Bernstein records go back only to 1828, so we can't find his 1814 birth record. Regardless, it was fun figuring out the Burgenland villages involved!

Facts to the Landscape History of the Öreg-Bakony Mountains, Dénes Saláta, Károly Penksza, Ákos Malatinszky, Árpád Kenéz; Institute of Environmental and Landscape Management, Szent István University; Gödöllo, Hungary; 2014.

Under my presumption that the land-use histories of the two areas are similar (as they both were under Hungarian rule throughout the cited era), I though it would be informative to share what these authors say about the landscape of the Öreg-Bakony Mountains. As such, I will edit and paraphrase what they say, though I will begin with a direct quote:

"Historically there were three basic vegetation types in the Carpathian basin. These types were treeless areas, wood steppes and closed forests. Human cultures settled on the treeless and wood steppe areas first. As the population of each ethnic group expanded, so did the need for more and more arable land, making the deforestation and transformation of closed forests an essential part of life. The settlements and memories of these transformation procedures have remained in traditional forest use, pasture management and agriculture. The examples of wood pastures and grazed forests are very poignant; they are the last models of a vanishing management system called clearing farming."

As mentioned in the paper's title, the authors studied the Öreg-Bakony Mountains, concentrating on two micro regions within it containing 36 villages and settlements believed to be representative of the Bakony Mountains and its management and farming traditions. In particular, the traditional forest use from the 9th to the 19th century was examined by using data that they believe provided an understanding of the diverse ethnographical, historically geographical, agricultural history and forestry history. Using their literature review, the stories of elder inhabitants, and the evidence still in place, they constructed a reasoned forest and land use history.

They found that initially after the Hungarian conquest of the Carpathian Basin in the late 9th century, the forests were used by the settled communities at no cost. Royal wooded properties were also established from the commonly used forests and were called wood provinces.

The primary use of forests in the 10th century was for acquiring food, particularly via hunting. Cutting of wood was unsystematic, though the need for wood began to grow as the volume of glass manufacturing, mining, metallurgy and other wood-based industries started to thrive.

[Ed. note: Burgenland has a history of similar industries in its more mountainous, forested areas.]

By the 11th Century, every easily-usable land area had been cultivated, so it became important to enforce protection of the forests. Evidence for this is in the word ardó, found in the geographic names from the 11th Century such as the Ardó settlement. Ardó comes from the contraction of erdo (forest) and óvó (protector). The protectors kept the forests safe and managed the woodlands. As populations expanded, hunting remained important but soon became secondary to grazing, acorn foraging and other uses.

Based on the still-existing farming traditions, the authors concluded that a huge number of livestock needed an equally huge amount of forage, which came from the forests. Feeding of foliage was widely used, with the ash species being the predominant species used for forage feeding, a fact enshrined in numerous geographical names in the research area (for example, the Koris [Ash] Mountain).

Closed forests, in the traditional system, were mostly used for grazing, acorn forage, cutting of tree foliage for fodder, and collection of fallen leaves. However, after the easily-cultivated fields had all been claimed, the crucial need for more arable land drove the population to deforest the woodlands. The first phase in the transformation of the sometimes thick and impenetrable forests was the so-called occupation, before the real clearing work.

There were several types of clearing work, depending on the geographical situation and habits of the settled population. The easiest way was the burning of forests; however, this was the most dangerous method and was forbidden early on in Hungary. Exceptions to the burning rules were made for forest workers, who made small fires for everyday use (cooking and heating), and for burning of harmful shrubs or poisonous plants on pastures.

During the process of clearing or the forming of wood pastures and grazed forests, the vegetation was often grazed first to utilize the available shoots and foliage. After grazing, the stripped forest was cleared to make useable fields. This clearing work was tedious, and workers were often motivated by concessions, for example, the clearers could keep the logs and the harvest of 1–3 years from the cleared field or, later, half of the yield.

De-stumping of trees was one of the most problematic portions of the work, as was the removal of prickly shrubs. Shrubs were cleared “with fire and iron” and grazing. There were three basic methods for de-stumping. The first was completed when the trees were cut down, with the roots cut out or not, depending on effort required. The second was the so-called stubbing overthrow, when roots were dug around (without cutting the tree) and were pulled out and overthrown with the help of the tree’s own weight. The third method was drying (called ringing in forestry terminology) when the outer bark was cut around, allowing the trees to dry out. Sometimes trees were just hammered around the trunk in order to damage tufts [dense clumps of trees]. In the earliest times, people simply excised the trees and started cultivating among the stumps in the field. The evidence for drying, clearing and other such activities can be found in geographical names, like aszó (dried), irtvány (clearing) or csonkás (truncated).

As noted above, grazing livestock was useful during clearing, as fresh shoots and leaves could be utilized as forage while the over-grazing opened the forest for the foresters. Tree species in the area (except for beech) shoot well from their trunks and roots, so their shoots could be grazed by animals. Cattle, hog and sheep were the most important species in the Hungarian livestock keeping-and-grazing customs. Forests were important sources of forage, especially in those areas where the proportion of open grasslands was low, as in the Bakony Mountains. The importance of grazing in forests could be demonstrated by the fact that sheep farming ceased in the Börzsöny Mountains due to a ban on grazing in forests. Grazing needed to be regulated from early times because some of the animal species grazed excessively or their shepherds damaged the trees. One of the most favorite foods of grazing animals were fresh shoots with leaves and buds, therefore animals were occasionally driven illegally into the forbidden parts of the forests to graze young saplings. In addition, shoots situated in the foliage of trees were also regularly cut and given to animals. These abuses later generated severe disputes.

The importance of grazing in forests was clear, but forest meadows were also important. However, the authors state that yield and quality of grasses in forests is lower than in meadows, with an annual yield of forest grasses per acre of only 300-600 pounds and a per acre forage value equal to about 150 pounds of meadow grass. Thus, one should expect noticeable destruction by grazing livestock in forests.

Cutting the foliage of trees for feeding used to be a common practice. The most suitable species for foliage fodder were ashes, limes, willows, maples, poplars, black locust, mulberry, oaks and hornbeam. Branches thinner than one inch were cut back to one third of the foliage (likely in June), bound into sheaves and dried. Withered sprouts were collected with carts, and were transported into stacks or haylofts for storage. This way livestock could be fed with green forage during winter even in years with very cold weather. The annual cutting of branches in this manner causes lasting damage, therefore it became forbidden quite early. It was allowed later only by necessity, for example in 1863 when Hungary suffered from a severe drought. According to historical experience, 125 pounds of foliage fodder is equal to 100 pounds of medium quality hay from meadows (a surprisingly high value!).

As a source of forage for livestock, forests played their most important role in hogs foraging for acorns. Forests producing great numbers of acorns were considered of high value, equal to the most valuable forests providing wood for construction (per the price in Werboczy’s 1514 Tripartitum book of laws). These two types of forests were considered 16 times more valuable than any other type of forests. Acorn yield per acre was 300-600 pounds in beechnut forest and 450-750 pounds in oak forest, so fattening one hog required about six acres of forest. The authors note that about 150,000 hogs were raised in the Bakony Mountains in 1847 (implying use of over 900,000 acres of forest for acorn foraging). Beechnut and oak acorns had great importance in sheep farming as well. Thus it was common for nobles in the area to the keep livestock in their forests and/or to lease the acorn yield of their forests (for several hundreds of Forints per season in 1842).

A secondary forest use in connection with livestock keeping was the collection of fallen leaves for bedding. This type of use caused damage in the forests similar to the cutting of shoots. During the collection for bedding, dry fallen leaves and parched grasses were raked together and carried away from forest floors, removing the natural supply of nutritive, organic soil matter, so this type of forest use was also soon forbidden in most of the forests. Such usage damaged the forests and their soils, as did the turning up and treading down of soil by foraging livestock.

There were no treeless pastures in the Bakony Mountains until the mid-18th century. Between the mid-19th and mid-20th century, grazed areas were kept cleared of brush and weeds by the owners of the common pastures via spring pasture clearings. The tools for such clearing efforts, mainly the mattock, sickle and thorn cutters, were pointed out by interviewees.

Besides livestock keeping, industries based on wood as raw material or fuel severely changed the woodlands as well. Although the domestic wood-carving  industry was significant in the region, it had little impact on the forests, unlike lime burning, charcoal burning, pearl-ash making and glass manufacturing.

Lime was important for everyday life, agriculture and industries, to such an extent that even poor people bought the lime powder remaining after lime burning. The process involved transporting locally mined limestone to a lime-kiln that was stoked for 3 or 4 days with wood. The most suitable species for fuel wood were Turkey oak, sessile oak and beech. With a typical kiln producing 25 tons of lime per batch and requiring a half pound of wood for each pound of lime produced, the demand for wood was large.

Charcoal burning was another activity in the Bakony Mountains. It provided important basic materials for households and industry. For a burning, ten to twelve cartloads of locally-cut beech trees were carefully stacked on flat ground into conical-topped, circular piles averaging 30 feet in diameter, with a protected "firing hole" (tunnel) into the middle of the stack. The outer surface was covered with a mesh of smaller branches and dry twigs and then that mesh was covered over with a mixture of soil, the powder from previous burnings, and dead fallen leaves. The stack was fired from the center via glowing embers placed through the firing hole and, once burning was well underway, the firing hole was filled in with more wood and sealed like the rest of the stack. A burning lasted for 6 to 7 days, being attended throughout to repair damage to the cone and open vent-holes, top to bottom, as needed for proper carbonization. After cooling, the charcoal was separated out and sold.

Another local profession in the Öreg-Bakony Mountains was pearlash-making, the most important component being potassium carbonate that was prepared, traditionally, by washing wood ash in lye. It was used primarily for glass production, whitening, tanning and saltpeter production and was internationally traded as early as the 14th century. Pearlash was produced by this traditional method in industrial amounts from the mid-18th Century to the early 19th Century, causing the destruction of nearly 6 million acres of forest in the Hungarian Kingdom during those few decades. In 1756, 600 tons of pearlash was produced by 41 kilns in the Bakony Mountains alone, and in 1864, export of pearlash from Hungary exceeded 3,600 tons.

Making wood ash for the production of pearlash was originally done by putting a glowing tinder into a hollow of a tree and waiting until the tree burned out from the inside. But that was not a safe method (mostly because of the potential for forest fires), risked damage to the ash from rain, and only produced a sackfull of ash from even a large tree. Burning wood above a stone-lined pit and collecting the ash was safer and allowed for volume production, so became the standard method. The largest amount of pearlash could be produced from raw foliage, bark, and the young sprouts and branches of leafy trees (as burning temperatures had to be kept low to enhance the potassium carbonate concentration). Even then, it was a low-yield process, producing only 1.45 units of pearlash per 1000 units of beech wood and only 0.45 units of pearlash from 1000 units of pine wood.

With locally produced quick-lime, charcoal and pearlash, glass production soon attained high importance in the Öreg-Bakony Mountains. Glass had been known from the time of the Hungarian Conquest and formal glass production grew continuously from the Middle Ages into the 17th Century, when glass become part of even peasant households. Glass was made from locally-found sand or pebbles with high silicon dioxide content, limestone and pearlash by fusing (via charcoal heat) and coloring with metal oxides. The woods huta and hütte (glass-house) in old geographical names provide evidence for the importance of this craft in the area.

[Ed. note: I'll end by again noting that these same industries—lime burning, charcoal burning, pearlash production and glass making—were popular in Burgenland too, implying similar usage of the native forests and a resulting similar destruction of them.]